Stem-loop sequence bma-mir-84-1

AccessionMI0026316 (change log)
DescriptionBrugia malayi miR-84-1 stem-loop
Gene family MIPF0000250; mir-84
Literature search

1 open access papers mention bma-mir-84-1
(3 sentences)

Stem-loop
   -uuuccaau        -   u cu           uaaag       agaa 
5'          ugcaauga ggc g  gagguaguuua     cugcgag    a
            |||||||| ||| |  |||||||||||     |||||||    a
3'          acguuauu ccg c  cucuaucgaau     gacgcuc    u
   uuucuuagu        u   u ac           -uuua       aaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This microRNA was experimentally validated from deep sequencing libraries in the closely related species Brugia pahangi [1].

Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold7: 1916768-1916871 [-]
intergenic
Database links

Mature sequence bma-miR-84-5p

Accession MIMAT0031761
Sequence

23 - 

ugagguaguuuauaaagcugcga

 - 45

Get sequence
Evidence experimental; Illumina [2]

Mature sequence bma-miR-84-3p

Accession MIMAT0031864
Sequence

61 - 

gcagauuuuaagcuaucuccac

 - 82

Get sequence
Evidence not experimental

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).
2
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).