Stem-loop sequence bma-mir-45

AccessionMI0026305 (change log)
DescriptionBrugia malayi miR-45 stem-loop
Gene family MIPF0000132; mir-44
Literature search

1 open access papers mention bma-mir-45
(1 sentences)

Stem-loop
   -----gauc     a   agu    -uu              g    ----      ca 
5'          guaaa cua   acca   cuggauguuucucu aguc    auaugu  a
            ||||| |||   ||||   |||||||||||||| ||||    ||||||  a
3'          cguuu ggu   uggu   gacuuacaaggaga ucag    uauaua  u
   acauauauu     -   -au    uac              -    cauc      uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This microRNA was experimentally validated from deep sequencing libraries in the closely related species Brugia pahangi [1].

Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold174: 59881-59988 [+]
intergenic
Database links

Mature sequence bma-miR-45

Accession MIMAT0031750
Sequence

64 - 

cgacuagaggaacauucagcau

 - 85

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).
2
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).