Stem-loop sequence bma-mir-2d

AccessionMI0026298 (change log)
DescriptionBrugia malayi miR-2d stem-loop
Literature search

3 open access papers mention bma-mir-2d
(32 sentences)

Stem-loop
   u      ---a   -      a    -          --       uu    uuu  uua 
5'  ucugaa    gug caagua cagc cguuguauca  uuuguga  uaug   ua   u
    ||||||    ||| |||||| |||| ||||||||||  |||||||  ||||   ||    
3'  agacuu    cgc guucau gucg gcgacguagu  agacacu  auac   au   c
   a      auaa   u      -    a          ua       --    --u  ucg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This microRNA was experimentally validated from deep sequencing libraries in the closely related species Brugia pahangi [1].

Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold153: 15939-16048 [+]
intergenic
Clustered miRNAs
< 10kb from bma-mir-2d
bma-mir-5840Bmal_v3_scaffold153: 6986-7093 [+]
bma-mir-2b-1Bmal_v3_scaffold153: 8299-8390 [+]
bma-mir-36bBmal_v3_scaffold153: 8423-8513 [+]
bma-mir-2dBmal_v3_scaffold153: 15939-16048 [+]
bma-mir-36dBmal_v3_scaffold153: 16078-16186 [+]
bma-mir-2iBmal_v3_scaffold153: 16336-16445 [+]
bma-mir-2h-1Bmal_v3_scaffold153: 18589-18706 [+]
bma-mir-2h-2Bmal_v3_scaffold153: 21047-21164 [-]
bma-mir-5839Bmal_v3_scaffold153: 22289-22393 [+]
bma-mir-2fBmal_v3_scaffold153: 23624-23729 [-]
Database links

Mature sequence bma-miR-2d

Accession MIMAT0031747
Sequence

64 - 

uaucacagaauugaugcagcgagc

 - 87

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).
2
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).