Stem-loop sequence bma-mir-252

AccessionMI0026293 (change log)
DescriptionBrugia malayi miR-252 stem-loop
Gene family MIPF0000285; mir-252
Literature search

1 open access papers mention bma-mir-252
(1 sentences)

Stem-loop
   ---acaauccucaa    aa     uc          u cc        ca  aa 
5'               ggau  gucau  uaaguaguag g  gcagguaa  ac  u
                 ||||  |||||  |||||||||| |  ||||||||  ||   
3'               ccua  cagua  auucaucguc c  uguccauu  ug  u
   uucacaaguucgua    -c     ca          u -u        --  ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This microRNA was experimentally validated from deep sequencing libraries in the closely related species Brugia pahangi [1].

Genome context
Coordinates (PRJNA10729_WB240; GCA_000002995.2) Overlapping transcripts
Bmal_v3_scaffold3: 1319133-1319237 [+]
intergenic
Database links

Mature sequence bma-miR-252

Accession MIMAT0031744
Sequence

24 - 

cuaaguaguagugccgcagguaa

 - 46

Get sequence
Evidence experimental; Illumina [2]

References

1
PMID:22216965 "Diversity in parasitic nematode genomes: the microRNAs of Brugia pahangi and Haemonchus contortus are largely novel" Winter AD, Weir W, Hunt M, Berriman M, Gilleard JS, Devaney E, Britton C BMC Genomics. 13:4(2012).
2
PMID:24824352 "Diversity and expression of microRNAs in the filarial parasite, Brugia malayi" Poole CB, Gu W, Kumar S, Jin J, Davis PJ, Bauche D, McReynolds LA PLoS One. 9:e96498(2014).