Stem-loop sequence bbe-mir-33-1

AccessionMI0026234 (change log)
DescriptionBranchiostoma belcheri miR-33-1 stem-loop
Gene family MIPF0000070; mir-33
Literature search

1 open access papers mention bbe-mir-33-1
(1 sentences)

Stem-loop
   aga     ug     g                    --u   u 
5'    ccugu  cuggg ugcauuguaguugcauugca   gug g
      |||||  ||||| ||||||||||||||||||||   |||  
3'    ggacg  gaccc acgugacgucaauguaacgu   uac u
   caa     ga     g                    cgu   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bbe-miR-33-5p

Accession MIMAT0031668
Sequence

16 - 

gugcauuguaguugcauugca

 - 36

Get sequence
Evidence not experimental

Mature sequence bbe-miR-33-3p

Accession MIMAT0031669
Sequence

53 - 

caauguaacugcagugcagcc

 - 73

Get sequence
Evidence not experimental

References

1
PMID:23335747 "Genome-wide analyses of amphioxus microRNAs reveal an immune regulation via miR-92d targeting C3" Yang R, Zheng T, Cai X, Yu Y, Yu C, Guo L, Huang S, Zhu W, Zhu R, Yan Q, Ren Z, Chen S, Xu A J Immunol. 190:1491-1500(2013).