Stem-loop sequence bbe-mir-31

AccessionMI0026233 (change log)
DescriptionBranchiostoma belcheri miR-31 stem-loop
Gene family MIPF0000064; mir-31
Stem-loop
   -----ugca   -     a          aga   ug         uuua     
5'          ggg ggacg ggagauggca   ugu  gcauagcug    cagu 
            ||| ||||| ||||||||||   |||  |||||||||    ||| u
3'          ccc cuugc ccuuugccgu   aca  cgugucggc    gucu 
   caacauuag   a     -          caa   gu         -uug     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bbe-miR-31-5p

Accession MIMAT0031666
Sequence

19 - 

uggcaagauguuggcauagcugu

 - 41

Get sequence
Evidence not experimental

Mature sequence bbe-miR-31-3p

Accession MIMAT0031667
Sequence

59 - 

gcugugcugacaaacugccguu

 - 80

Get sequence
Evidence not experimental

References

1
PMID:23335747 "Genome-wide analyses of amphioxus microRNAs reveal an immune regulation via miR-92d targeting C3" Yang R, Zheng T, Cai X, Yu Y, Yu C, Guo L, Huang S, Zhu W, Zhu R, Yan Q, Ren Z, Chen S, Xu A J Immunol. 190:1491-1500(2013).