Stem-loop sequence bbe-mir-29b

AccessionMI0026232 (change log)
DescriptionBranchiostoma belcheri miR-29b stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   cacugcagguuuu   -         -       c        g g     ggc 
5'              cua uccuggaag acugguu caaguggu g uagau   a
                ||| ||||||||| ||||||| |||||||| | |||||   c
3'              gau aggacuuuc ugacuaa guuuacca c aucua   u
   -------------   c         g       a        - g     gag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bbe-miR-29b-5p

Accession MIMAT0031664
Sequence

26 - 

acugguuccaagugguggguaga

 - 48

Get sequence
Evidence not experimental

Mature sequence bbe-miR-29b-3p

Accession MIMAT0031665
Sequence

62 - 

uagcaccauuugaaaucagugcu

 - 84

Get sequence
Evidence not experimental

References

1
PMID:23335747 "Genome-wide analyses of amphioxus microRNAs reveal an immune regulation via miR-92d targeting C3" Yang R, Zheng T, Cai X, Yu Y, Yu C, Guo L, Huang S, Zhu W, Zhu R, Yan Q, Ren Z, Chen S, Xu A J Immunol. 190:1491-1500(2013).