Stem-loop sequence bbe-mir-29a

AccessionMI0026231 (change log)
DescriptionBranchiostoma belcheri miR-29a stem-loop
Gene family MIPF0000009; mir-29
Stem-loop
   uccugggaau    u    g  -           gu          -  gaa 
5'           ucug gcac ga agcugauuuca  uggugcuaga ug   g
             |||| |||| || |||||||||||  |||||||||| ||    
3'           ggac cgug cu uugacuaaagu  accacgaucu gc   u
   ---------c    u    g  a           au          u  ggc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bbe-miR-29a-5p

Accession MIMAT0031662
Sequence

24 - 

gcugauuucaguuggugcuaga

 - 45

Get sequence
Evidence not experimental

Mature sequence bbe-miR-29a-3p

Accession MIMAT0031663
Sequence

61 - 

uagcaccauaugaaaucaguuau

 - 83

Get sequence
Evidence not experimental

References

1
PMID:23335747 "Genome-wide analyses of amphioxus microRNAs reveal an immune regulation via miR-92d targeting C3" Yang R, Zheng T, Cai X, Yu Y, Yu C, Guo L, Huang S, Zhu W, Zhu R, Yan Q, Ren Z, Chen S, Xu A J Immunol. 190:1491-1500(2013).