Stem-loop sequence bbe-mir-22

AccessionMI0026225 (change log)
DescriptionBranchiostoma belcheri miR-22 stem-loop
Gene family MIPF0000053; mir-22
Literature search

1 open access papers mention bbe-mir-22
(4 sentences)

Stem-loop
   c      a                -  c       c  u   u 
5'  gcucug gaagcguagcucuuca cu gguagcu ug guu a
    |||||| |||||||||||||||| || ||||||| || ||| u
3'  cgggac cuucgugucgagaagu ga ccgucga ac uag c
   a      -                a  -       a  -   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bbe-miR-22-5p

Accession MIMAT0031652
Sequence

16 - 

agcucuucacucgguagcucug

 - 37

Get sequence
Evidence not experimental

Mature sequence bbe-miR-22-3p

Accession MIMAT0031653
Sequence

52 - 

aagcugccagaugaagagcugu

 - 73

Get sequence
Evidence not experimental

References

1
PMID:23335747 "Genome-wide analyses of amphioxus microRNAs reveal an immune regulation via miR-92d targeting C3" Yang R, Zheng T, Cai X, Yu Y, Yu C, Guo L, Huang S, Zhu W, Zhu R, Yan Q, Ren Z, Chen S, Xu A J Immunol. 190:1491-1500(2013).