Stem-loop sequence bbe-mir-135b

AccessionMI0026183 (change log)
DescriptionBranchiostoma belcheri miR-135b stem-loop
Gene family MIPF0000028; mir-135
Stem-loop
     gugu         uu    cuu      -   cu 
5' cc    ccaauggcu  cauc   ugugaa ugu  g
   ||    |||||||||  ||||   |||||| |||   
3' gg    gguuauugg  guag   acacuu aca  a
     aauu         gg    -cu      g   cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bbe-miR-135b-5p

Accession MIMAT0031589
Sequence

9 - 

aauggcuuucauccuuuguga

 - 29

Get sequence
Evidence not experimental

References

1
PMID:23335747 "Genome-wide analyses of amphioxus microRNAs reveal an immune regulation via miR-92d targeting C3" Yang R, Zheng T, Cai X, Yu Y, Yu C, Guo L, Huang S, Zhu W, Zhu R, Yan Q, Ren Z, Chen S, Xu A J Immunol. 190:1491-1500(2013).