Stem-loop sequence bbe-mir-135a

AccessionMI0026182 (change log)
DescriptionBranchiostoma belcheri miR-135a stem-loop
Gene family MIPF0000028; mir-135
Stem-loop
   -------------  g    a           cu          uau 
5'              gu uucu uggcuuucauc  augugaaugu   c
                || |||| |||||||||||  ||||||||||    
3'              ca aaga acugaaggugg  uacacuugua   g
   ucaaaggugugug  g    a           -u          cac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence bbe-miR-135a-5p

Accession MIMAT0031587
Sequence

7 - 

uauggcuuucauccuauguga

 - 27

Get sequence
Evidence not experimental

Mature sequence bbe-miR-135a-3p

Accession MIMAT0031588
Sequence

45 - 

cacauugguggaagucaaaga

 - 65

Get sequence
Evidence not experimental

References

1
PMID:23335747 "Genome-wide analyses of amphioxus microRNAs reveal an immune regulation via miR-92d targeting C3" Yang R, Zheng T, Cai X, Yu Y, Yu C, Guo L, Huang S, Zhu W, Zhu R, Yan Q, Ren Z, Chen S, Xu A J Immunol. 190:1491-1500(2013).