Stem-loop sequence ppe-MIR8130

AccessionMI0026163 (change log)
DescriptionPrunus persica miR8130 stem-loop
Stem-loop
     u       c          g     g                         c         ccg  ---       a u    u             acucagccacucuuccaacguggauu 
5' ca agaaugu uauuuguugu uuuuu guuuugucaugauuggauaucucgu cuuugaugu   gu   gugacaa g gggu ccuuguuggaagg                          c
   || ||||||| |||||||||| ||||| ||||||||||||||||||||||||| |||||||||   ||   ||||||| | |||| |||||||||||||                          a
3' gu ucuuaca guaaacagca aaaaa caaaacaguacuagccuauagagca ggaacuaca   ca   cacuguu c ccca ggaaugaccuucc                          a
     c       c          g     g                         c         -aa  agc       c c    c             cacccgacgacagacgguaggcuuaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG5: 13056273-13056521 [+]
intergenic
Database links

Mature sequence ppe-miR8130-5p

Accession MIMAT0031556
Sequence

79 - 

ggguuccuuguuggaaggacu

 - 99

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppe-miR8130-3p

Accession MIMAT0031557
Sequence

151 - 

cccuuccaguaaggcaccccc

 - 171

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).