Stem-loop sequence ppe-MIR7122b

AccessionMI0026149 (change log)
DescriptionPrunus persica miR7122b stem-loop
Gene family MIPF0000771; MIR1509
Literature search

1 open access papers mention ppe-MIR7122b
(3 sentences)

Stem-loop
          uuc               u    u      c    aa   -ac   -    uc 
5' ggguuca   cauuuuuuuauacaa gaaa cacggu gaga  aga   aga agau  u
   |||||||   ||||||||||||||| |||| |||||| ||||  |||   ||| ||||  u
3' cccaggu   guagagaaauauguu cuuu gugccg cucu  ucu   ucu ucua  u
          cau               c    -      u    ca   cuc   c    uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG1: 2244304-2244423 [+]
intergenic
Clustered miRNAs
< 10kb from ppe-MIR7122b
ppe-MIR7122bchrG1: 2244304-2244423 [+]
ppe-MIR7122achrG1: 2253872-2254049 [+]
Database links

Mature sequence ppe-miR7122b-5p

Accession MIMAT0031529
Sequence

18 - 

uuauacaaugaaaucacggucg

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppe-miR7122b-3p

Accession MIMAT0031530
Sequence

86 - 

ccguguuuccuuguauaaag

 - 105

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).