Stem-loop sequence ppe-MIR8123

AccessionMI0026147 (change log)
DescriptionPrunus persica miR8123 stem-loop
Stem-loop
      a                    c                g    aug 
5' gac ucugcuugagcaauggcaca agcccucgguuguuga cuuu   c
   ||| |||||||||||||||||||| |||||||||||||||| ||||    
3' cug agacgaacucguuaccgugu ucgggagucaacaacu gaaa   a
      -                    u                -    gag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG3: 3047519-3047616 [+]
intergenic
Database links

Mature sequence ppe-miR8123-5p

Accession MIMAT0031525
Sequence

11 - 

ugagcaauggcacacagcccu

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppe-miR8123-3p

Accession MIMAT0031526
Sequence

75 - 

uugugccauugcucaagc

 - 92

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).