Stem-loop sequence ppe-MIR2111d

AccessionMI0026144 (change log)
DescriptionPrunus persica miR2111d stem-loop
Gene family MIPF0000754; MIR2111
Stem-loop
      u     c               ug   u      -     cau 
5' ggu aggau ggguaaucugcaucc  agg uuagau cagca   a
   ||| ||||| |||||||||||||||  ||| |||||| |||||    
3' cca uccug uccauuaggcguggg  ucc ggucua guugu   u
      c     c               gu   u      u     uca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG6: 25321069-25321161 [-]
intergenic
Database links

Mature sequence ppe-miR2111d

Accession MIMAT0031520
Sequence

14 - 

uaaucugcauccugagguuua

 - 34

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).