Stem-loop sequence ppe-MIR535a

AccessionMI0026138
DescriptionPrunus persica miR535a stem-loop
Gene family MIPF0000136; MIR535
Stem-loop
   u   u   gu   u                         cg   c     aa 
5'  gau gac  ugu ugacaacgagagagagcacgcuugu  gca ccaug  a
    ||| |||  ||| |||||||||||||||||||||||||  ||| |||||  g
3'  cua cug  acg acuguuguucucucucgugcgggca  ugu gguac  g
   a   u   --   u                         uu   a     cg 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prupe1_0) Overlapping transcripts
KB639104.1: 17689593-17689697 [+]
intergenic
Clustered miRNAs
< 10kb from ppe-MIR535a
ppe-MIR535bKB639104.1: 17685853-17685981 [+]
ppe-MIR535aKB639104.1: 17689593-17689697 [+]

Mature sequence ppe-miR535a

Accession MIMAT0031514
Sequence

15 - 

ugacaacgagagagagcacgc

 - 35

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).