Stem-loop sequence ppe-MIR535a

AccessionMI0026138 (change log)
DescriptionPrunus persica miR535a stem-loop
Gene family MIPF0000136; MIR535
Stem-loop
   u   u   gu   u                         cg   c     aa 
5'  gau gac  ugu ugacaacgagagagagcacgcuugu  gca ccaug  a
    ||| |||  ||| |||||||||||||||||||||||||  ||| |||||  g
3'  cua cug  acg acuguuguucucucucgugcgggca  ugu gguac  g
   a   u   --   u                         uu   a     cg 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG8: 18434050-18434154 [+]
intergenic
Clustered miRNAs
< 10kb from ppe-MIR535a
ppe-MIR535bchrG8: 18430310-18430438 [+]
ppe-MIR535achrG8: 18434050-18434154 [+]
Database links

Mature sequence ppe-miR535a

Accession MIMAT0031514
Sequence

15 - 

ugacaacgagagagagcacgc

 - 35

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).