Stem-loop sequence ppe-MIR399c

AccessionMI0026123 (change log)
DescriptionPrunus persica miR399c stem-loop
Gene family MIPF0000015; MIR399
Literature search

4 open access papers mention ppe-MIR399c
(5 sentences)

Stem-loop
      uacuug   ag     -         a      uc   c     -      -  ---cu     cuga    gcu 
5' gca      uca  uaagc aaagcaguc uagggc  cuc uucuu ggcagg ca     gguga    ugca   a
   |||      |||  ||||| ||||||||| ||||||  ||| ||||| |||||| ||     |||||    ||||    
3' cgu      agu  auucg uuucguuag aucccg  gag aagaa ccgucc gu     ucacu    augu   c
      --uuaa   -a     g         c      uu   -     a      a  uacuu     -aaa    aaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG3: 1446492-1446638 [+]
intergenic
Clustered miRNAs
< 10kb from ppe-MIR399c
ppe-MIR399hchrG3: 1436637-1436767 [+]
ppe-MIR399cchrG3: 1446492-1446638 [+]
Database links

Mature sequence ppe-miR399c

Accession MIMAT0031499
Sequence

100 - 

ugccaaagaagaguugcccua

 - 120

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).