Stem-loop sequence ppe-MIR396a

AccessionMI0026118 (change log)
DescriptionPrunus persica miR396a stem-loop
Gene family MIPF0000047; MIR396
Literature search

6 open access papers mention ppe-MIR396a
(15 sentences)

Stem-loop
   uuc                -  --c     ccuuuca      au  -  ua 
5'    cacagcuuucuugaac gu   ugugc       ggaacu  ca ga  a
      |||||||||||||||| ||   |||||       ||||||  || ||   
3'    gugucgaaagaacuug ca   acacg       ccuuga  gu cu  u
   aaa                a  aaa     ---auaa      -c  a  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG1: 40254306-40254403 [-]
intergenic
Database links

Mature sequence ppe-miR396a

Accession MIMAT0031494
Sequence

1 - 

uuccacagcuuucuugaacgu

 - 21

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).