Stem-loop sequence ppe-MIR395d

AccessionMI0026106 (change log)
DescriptionPrunus persica miR395d stem-loop
Gene family MIPF0000016; MIR395
Literature search

4 open access papers mention ppe-MIR395d
(15 sentences)

Stem-loop
   --auccgugguaauguacuuauuguagaagcugugaugaaaaaagaggaaa  uu              a         ug c       u     --a      c  u 
5'                                                    ua  gucaggugucaccg gaguucucu  a cacuuca uggga   auaauu au c
                                                      ||  |||||||||||||| |||||||||  | ||||||| |||||   |||||| ||  
3'                                                    au  uaguuuacgguggu cucaagggg  u gugaagu acccu   uauuaa ua u
   uagguaccgccaccuauacaccuuucgaacauucucgaaacaauaagaaac  uu              c         gu u       c     aua      c  g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG1: 27764041-27764256 [-]
intergenic
Clustered miRNAs
< 10kb from ppe-MIR395d
ppe-MIR395bchrG1: 27773971-27774095 [+]
ppe-MIR395ochrG1: 27768992-27769074 [+]
ppe-MIR395nchrG1: 27764648-27764750 [-]
ppe-MIR395ichrG1: 27764456-27764573 [-]
ppe-MIR395cchrG1: 27764279-27764386 [-]
ppe-MIR395dchrG1: 27764041-27764256 [-]
ppe-MIR395jchrG1: 27754874-27754989 [-]
Database links

Mature sequence ppe-miR395d

Accession MIMAT0031482
Sequence

126 - 

cugaaguguuugggggaacuc

 - 146

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).