Stem-loop sequence ppe-MIR395c

AccessionMI0026105 (change log)
DescriptionPrunus persica miR395c stem-loop
Gene family MIPF0000016; MIR395
Literature search

3 open access papers mention ppe-MIR395c
(13 sentences)

Stem-loop
                 a         ug c       u     --a     ---  u 
5' gucaagugucacug gaguucccu  a cacuuca uggga   auaau   uc u
   |||||||||||||| |||||||||  | ||||||| |||||   |||||   || u
3' uaguuuacggugau cucaagggg  u gugaagu auucu   uauua   ag c
                 c         gu u       c     aua     acu  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG1: 27764279-27764386 [-]
intergenic
Clustered miRNAs
< 10kb from ppe-MIR395c
ppe-MIR395bchrG1: 27773971-27774095 [+]
ppe-MIR395ochrG1: 27768992-27769074 [+]
ppe-MIR395nchrG1: 27764648-27764750 [-]
ppe-MIR395ichrG1: 27764456-27764573 [-]
ppe-MIR395cchrG1: 27764279-27764386 [-]
ppe-MIR395dchrG1: 27764041-27764256 [-]
ppe-MIR395jchrG1: 27754874-27754989 [-]
Database links

Mature sequence ppe-miR395c

Accession MIMAT0031481
Sequence

73 - 

cugaaguguuugggggaacuc

 - 93

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).