Stem-loop sequence ppe-MIR395a

AccessionMI0026103 (change log)
DescriptionPrunus persica miR395a stem-loop
Gene family MIPF0000016; MIR395
Literature search

3 open access papers mention ppe-MIR395a
(13 sentences)

Stem-loop
   gc          c  u  a                  u      u  uaugc 
5'   aucagauggc cc ag guucccucaaacacuuca uggaga ua     c
     |||||||||| || || |||||||||||||||||| |||||| ||      
3'   uaguuuacug gg uc cagggggguuugugaagu aucuuu au     u
   cc          a  u  c                  c      c  cucuc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG1: 27742367-27742472 [+]
intergenic
Clustered miRNAs
< 10kb from ppe-MIR395a
ppe-MIR395echrG1: 27739475-27739582 [-]
ppe-MIR395gchrG1: 27739652-27739769 [-]
ppe-MIR395lchrG1: 27739824-27739926 [-]
ppe-MIR395achrG1: 27742367-27742472 [+]
Database links

Mature sequence ppe-miR395a-5p

Accession MIMAT0031477
Sequence

20 - 

guucccucaaacacuucauu

 - 39

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppe-miR395a-3p

Accession MIMAT0031478
Sequence

69 - 

cugaaguguuuggggggaccc

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).