Stem-loop sequence ppe-MIR394b

AccessionMI0026102 (change log)
DescriptionPrunus persica miR394b stem-loop
Gene family MIPF0000100; MIR394
Literature search

3 open access papers mention ppe-MIR394b
(4 sentences)

Stem-loop
                 ccuug        g  a        u   u         uauuca  a   cac          u 
5' ggguuucucagggg     uugcagag ca uuuggcau cug ccaccucca      cu gua   auagaagaag u
   ||||||||||||||     |||||||| || |||||||| ||| |||||||||      || |||   ||||||||||  
3' cucaaagagucucu     aaugucuc gu aaacugua gac gguggaggu      ga cau   uauuuucuuu u
                 cuuua        g  c        c   u         ---cuc  a   -uu          c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG1: 46215543-46215698 [-]
intergenic
Database links

Mature sequence ppe-miR394b

Accession MIMAT0031476
Sequence

33 - 

uuggcauucuguccaccucc

 - 52

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).