Stem-loop sequence ppe-MIR172c

AccessionMI0026097 (change log)
DescriptionPrunus persica miR172c stem-loop
Gene family MIPF0000035; MIR172
Literature search

9 open access papers mention ppe-MIR172c
(35 sentences)

Stem-loop
                        aca        ----u     gu       ua    ucgaguuaauugguacuacuaacaccacca 
5' ggugcggcaucaucaagauuc   uacuuuag     gaggg  cuaccuu  ucga                              a
   |||||||||||||||||||||   ||||||||     |||||  |||||||  ||||                               
3' cuacgucguaguaguucuaag   gugaaguu     uuucc  gauggaa  agcu                              u
                        --g        ucaag     uu       --    caugauuuccuucaagcucauguuuuuagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG6: 4926841-4927008 [-]
intergenic
Database links

Mature sequence ppe-miR172c

Accession MIMAT0031471
Sequence

147 - 

ggaaucuugaugaugcugcau

 - 167

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).