Stem-loop sequence ppe-MIR171d

AccessionMI0026094 (change log)
DescriptionPrunus persica miR171d stem-loop
Gene family MIPF0000104; MIR171_2
Literature search

6 open access papers mention ppe-MIR171d
(18 sentences)

Stem-loop
         g   u  u                  -a       uauacuuuuuggauauauccauccauccauucau 
5' caagua aca gg gugauauugguucgguuc  uaucuuu                                  c
   |||||| ||| || ||||||||||||||||||  |||||||                                  c
3' guucgu ugu uc cacuauaacuaagccgag  guagaaa                                  a
         a   -  u                  ca       caaacacuaagcacuucacacuaccuaccuaccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG2: 29621754-29621904 [-]
intergenic
Database links

Mature sequence ppe-miR171d-5p

Accession MIMAT0031466
Sequence

14 - 

ugugauauugguucgguucaua

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ppe-miR171d-3p

Accession MIMAT0031467
Sequence

120 - 

cgagccgaaucaauaucacuc

 - 140

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).