Stem-loop sequence ppe-MIR169j

AccessionMI0026091 (change log)
DescriptionPrunus persica miR169j stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

7 open access papers mention ppe-MIR169j
(20 sentences)

Stem-loop
          -      ua       au         u      -          u    u     c  cc  - -      cucucucucucuc       auaaug    gc 
5' ggaagaa aggucc  caugagg  aaagagccu guuuug uagccaagga gacu gccug ag  uc c caaggg             ucuaaau      uggc  u
   ||||||| ||||||  |||||||  ||||||||| |||||| |||||||||| |||| ||||| ||  || | ||||||             |||||||      ||||   
3' ccuucuu uccagg  guacucu  uuucuugga cagagc aucgguuccu cuga cggac uc  ag g guuccu             agauuug      aucg  a
          c      uc       au         -      c          -    -     a  -u  u u      ------------a       guucga    au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG1: 23399808-23400011 [-]
intergenic
Database links

Mature sequence ppe-miR169j

Accession MIMAT0031463
Sequence

41 - 

uagccaaggaugacuugccugc

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).