Stem-loop sequence ppe-MIR169h

AccessionMI0026089 (change log)
DescriptionPrunus persica miR169h stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

7 open access papers mention ppe-MIR169h
(20 sentences)

Stem-loop
           -u   aaa       -          a   u   -        a  a        -ca   -uu  aa  a    aa   auc 
5' ggaagaga  guc   caugaaa aaaggagcuu guu ggu agccaagg ug cuugccug   gcc   cu  ag gggu  uca   a
   ||||||||  |||   ||||||| |||||||||| ||| ||| |||||||| || ||||||||   |||   ||  || ||||  |||   a
3' ccuucucu  cag   guacuuu uuuucuugaa cag uca ucgguucc ac gaacggac   ugg   ga  uc ccca  agu   a
           cu   auc       a          -   c   a        -  -        ucc   uuu  --  -    aa   cua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG4: 10148140-10148313 [+]
intergenic
Database links

Mature sequence ppe-miR169h

Accession MIMAT0031461
Sequence

40 - 

uagccaaggaugacuugccugc

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).