Stem-loop sequence ppe-MIR169a

AccessionMI0026083 (change log)
DescriptionPrunus persica miR169a stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

7 open access papers mention ppe-MIR169a
(20 sentences)

Stem-loop
             u   u      agcac      u gg u  c         ug           uuu  agua   --    u 
5' agucucagag guu acauga     aagaga u  a ug agccaagga  acuugccggca   ac    cuc  uugc u
   |||||||||| ||| ||||||     |||||| |  | || |||||||||  |||||||||||   ||    |||  |||| u
3' ucagagucuc cga uguacu     uucucu g  u ac ucgguuucu  ugaacggccgu   ug    gag  gacg a
             -   c      -cuuc      c uu u  a         gu           --u  ----   uu    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG1: 5674587-5674743 [+]
intergenic
Database links

Mature sequence ppe-miR169a

Accession MIMAT0031455
Sequence

41 - 

cagccaaggaugacuugccgg

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).