Stem-loop sequence ppe-MIR166d

AccessionMI0026076 (change log)
DescriptionPrunus persica miR166d stem-loop
Gene family MIPF0000004; MIR166
Literature search

7 open access papers mention ppe-MIR166d
(36 sentences)

Stem-loop
         u   cuu   a        uu      cu   g      -u   -  ugaucuguauuucuuauagaucaaccuguau 
5' gaagcu uag   uug ggggaaug  gucugg  cga gacacu  uuc cu                               a
   |||||| |||   ||| ||||||||  ||||||  ||| ||||||  ||| ||                                
3' cuucgg auu   aac ccccuuac  cggacc  gcu cuguga  aag gg                               u
         u   --u   c        uu      ag   g      uu   u  uuuucgguauauauacauauggaucuauauu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG2: 23268458-23268623 [+]
intergenic
Database links

Mature sequence ppe-miR166d

Accession MIMAT0031448
Sequence

131 - 

ucggaccaggcuucauucccc

 - 151

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).