Stem-loop sequence ppe-MIR166b

AccessionMI0026074 (change log)
DescriptionPrunus persica miR166b stem-loop
Gene family MIPF0000004; MIR166
Literature search

7 open access papers mention ppe-MIR166b
(36 sentences)

Stem-loop
                 uc               c    ca  cg  gag 
5' aguugaggggaaug  gucugguucgagauc uuca  ac  ug   c
   ||||||||||||||  ||||||||||||||| ||||  ||  ||   u
3' ucaacuccccuuac  cggaccaggcuuuag aagu  ug  ac   u
                 uu               u    -c  au  gaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG8: 20544987-20545082 [+]
intergenic
Database links

Mature sequence ppe-miR166b

Accession MIMAT0031446
Sequence

70 - 

ucggaccaggcuucauucccc

 - 90

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).