Stem-loop sequence ppe-MIR156c

AccessionMI0026058 (change log)
DescriptionPrunus persica miR156c stem-loop
Gene family MIPF0000008; MIR156
Literature search

14 open access papers mention ppe-MIR156c
(60 sentences)

Stem-loop
              ----   ga  auag     uaaaau    g   cucaa  uuga   ua        -     -        a  aa    gg   uu     aa 
5' ucucuguggau    gug  au    uaaag      aggg aag     gc    agc  cugacaga agaga gugagcac ca  cgca  caa  guaua  a
   |||||||||||    |||  ||    |||||      |||| |||     ||    |||  |||||||| ||||| |||||||| ||  ||||  |||  |||||   
3' agagacacuua    cac  ua    guuuc      uccc uuc     cg    ucg  gacugucu ucucu cacucgug gu  gcgu  guu  cauau  g
              aauu   uc  ----     ugaccu    g   -ccgc  -ucg   uc        c     u        c  -g    -g   -c     ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Prunus_persica_NCBIv2; GCA_000346465.2) Overlapping transcripts
chrG7: 21702295-21702495 [+]
intergenic
Database links

Mature sequence ppe-miR156c

Accession MIMAT0031430
Sequence

59 - 

ugacagaagagagugagcac

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:22909020 "Unique expression, processing regulation, and regulatory network of peach (Prunus persica) miRNAs" Zhu H, Xia R, Zhao B, An YQ, Dardick CD, Callahan AM, Liu Z BMC Plant Biol. 12:149(2012).