Stem-loop sequence mmu-mir-3473g

AccessionMI0026054 (change log)
Symbol MGI:Mir3473g
DescriptionMus musculus miR-3473g stem-loop
Literature search

3 open access papers mention mmu-mir-3473g
(69 sentences)

Stem-loop
   -------c   gca  u       g   u   cac      a        a   u   a         g  a 
5'         ucu   ag ggagcaa ugc cac   cgagcc ucucucca ccu cau uuuguauuu uu g
           |||   || ||||||| ||| |||   |||||| |||||||| ||| ||| ||||||||| ||  
3'         agg   uc ucucguu aug gug   guuugg agaggggu gga gug aaacaugaa aa a
   uugacacc   aaa  u       -   u   -ac      g        c   -   a         g  c 
Get sequence
Deep sequencing
777 reads, 166 reads per million, 92 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr2: 126902250-126902385 [-]
sense
OTTMUST00000038174 ; RP23-130L11.5-003; intron 9
OTTMUST00000037953 ; RP23-130L11.5-001; intron 14
ENSMUST00000143700 ; Sppl2a-003; intron 9
ENSMUST00000028844 ; Sppl2a-001; intron 14
Database links

Mature sequence mmu-miR-3473g

Accession MIMAT0031427
Sequence

77 - 

caaaagugaggcuggggaga

 - 96

Get sequence
Deep sequencing716 reads, 74 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1