![]() |
miRBase |
![]() |
![]() |
Stem-loop sequence mmu-mir-3473g |
|||||
Accession | MI0026054 (change log) | ||||
Symbol | MGI:Mir3473g | ||||
Description | Mus musculus miR-3473g stem-loop | ||||
Literature search |
![]()
3 open access papers mention mmu-mir-3473g | ||||
Stem-loop |
-------c gca u g u cac a a u a g a 5' ucu ag ggagcaa ugc cac cgagcc ucucucca ccu cau uuuguauuu uu g ||| || ||||||| ||| ||| |||||| |||||||| ||| ||| ||||||||| || 3' agg uc ucucguu aug gug guuugg agaggggu gga gug aaacaugaa aa a uugacacc aaa u - u -ac g c - a g c |
||||
Deep sequencing |
| ||||
Confidence |
Annotation confidence: not enough data
| ||||
Genome context |
|
||||
Database links |
Mature sequence mmu-miR-3473g |
|
Accession | MIMAT0031427 |
Sequence |
77 - caaaagugaggcuggggaga - 96 |
Deep sequencing | 716 reads, 74 experiments |
Evidence | experimental; Illumina [1] |
Predicted targets |
|
References |
|
1 |
PMID:23185045
"Profiling of T helper cell-derived small RNAs reveals unique antisense transcripts and differential association of miRNAs with argonaute proteins 1 and 2"
Nucleic Acids Res. 41:1164-1177(2013).
|