Stem-loop sequence mmu-mir-8118

AccessionMI0026050 (change log)
Symbol MGI:Mir8118
DescriptionMus musculus miR-8118 stem-loop
Stem-loop
   -acaa   -aaaacaa     ------     cu                      g  uugauaaa 
5'      gcu        guccc      cauuc  gugucggcauagucauguuugu cu        c
        |||        |||||      |||||  |||||||||||||||||||||| ||        a
3'      cga        caggg      guaag  cacagucguaucaguacaaaca ga        a
   gacua   aaggagac     acguuc     au                      g  ugagggac 
Get sequence
Deep sequencing
151 reads, 6.12 reads per million, 49 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr4: 33438081-33438209 [+]
sense
OTTMUST00000010986 ; Rngtt-001; intron 13
OTTMUST00000010987 ; Rngtt-002; intron 13
ENSMUST00000108153 ; Rngtt-002; intron 13
ENSMUST00000029942 ; Rngtt-001; intron 13
Database links

Mature sequence mmu-miR-8118

Accession MIMAT0031424
Sequence

73 - 

gacaaacaugacuaugcugaca

 - 94

Get sequence
Deep sequencing133 reads, 46 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1