Stem-loop sequence mmu-mir-8117

AccessionMI0026049 (change log)
Symbol MGI:Mir8117
DescriptionMus musculus miR-8117 stem-loop
Stem-loop
   ------------------------------ggga    u ug       uug     -guugg  g  ac 
5'                                   uucc g  ugggccc   caggu      gc ag  u
                                     |||| |  |||||||   |||||      || ||   
3'                                   aagg u  gcucggg   guccg      cg uc  c
   ugggcccggacuggaccccguguucggggaagac    - gu       ---     auggaa  g  gc 
Get sequence
Deep sequencing
344 reads, 185 reads per million, 54 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr5: 50252762-50252868 [+]
intergenic
Database links

Mature sequence mmu-miR-8117

Accession MIMAT0031423
Sequence

62 - 

gcucguguggaacagaagggg

 - 82

Get sequence
Deep sequencing68 reads, 23 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1