Stem-loop sequence mmu-mir-8115

AccessionMI0026047
Symbol MGI:Mir8115
DescriptionMus musculus miR-8115 stem-loop
Stem-loop
ccc    ac    ---acu  -a              acca  g  g     -   a u  a u 
   ugga  ugga      gc  ggugguugggagcc    ug ug uguug gga g ga c u
   ||||  ||||      ||  ||||||||||||||    || || ||||| ||| | || |  
   acuu  accu      cg  ucaucaauucucgg    ac ac auaac ccu c cu g g
-aa    cc    cucuac  ag              --ga  a  g     g   - -  - a 
Get sequence
Deep sequencing
54 reads, 13.2 reads per million, 29 experiments
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38) Overlapping transcripts
chr5: 122682597-122682715 [+]
sense
OTTMUST00000066138 ; P2rx7-002; intron 12
OTTMUST00000066139 ; P2rx7-003; intron 12
OTTMUST00000066137 ; P2rx7-001; exon 13
ENSMUST00000121489 ; P2rx7-002; intron 12
ENSMUST00000031425 ; P2rx7-003; intron 12
ENSMUST00000100737 ; P2rx7-001; exon 13
Database links

Mature sequence mmu-miR-8115

Accession MIMAT0031421
Sequence

68 - 

ccgcaauagcaacaagggcucu

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1