Stem-loop sequence mmu-mir-8105

AccessionMI0026035 (change log)
Symbol MGI:Mir8105
DescriptionMus musculus miR-8105 stem-loop
Stem-loop
   ug   gaa   -g    gaagaa     g        c  a    ua 
5'   cuu   ccu  gguc      ucggg cucgccag cg cucc  a
     |||   |||  ||||      ||||| |||||||| || ||||   
3'   gag   gga  cuag      agccc gagcgguc gc gagg  a
   -a   gag   ga    -----a     a        a  g    cg 
Get sequence
Deep sequencing
457 reads, 0 reads per million, 54 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr10: 128458680-128458768 [+]
intergenic
Database links

Mature sequence mmu-miR-8105

Accession MIMAT0031409
Sequence

53 - 

aggcgacuggcgagacccgaag

 - 74

Get sequence
Deep sequencing443 reads, 51 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1