Stem-loop sequence mmu-mir-497b

AccessionMI0026030 (change log)
Symbol MGI:Mir497b
DescriptionMus musculus miR-497b stem-loop
Gene family MIPF0000231; mir-497
Literature search

45 open access papers mention mmu-mir-497b
(603 sentences)

Stem-loop
   -----  --a     g c     ----ua           a  c    g         gacg    ca 
5'      uc   ucggu c uccca      cccucgcucua ca caca ugugguuug    uggc  c
        ||   ||||| | |||||      ||||||||||| || |||| |||||||||    ||||   
3'      ag   agcug g ggggu      gggggcggggu gu gugu acaccaaac    gccg  a
   acaga  gag     g u     caggac           c  c    g         --au    ug 
Get sequence
Deep sequencing
344 reads, 0 reads per million, 57 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr11: 70234692-70234816 [-]
intergenic
Clustered miRNAs
< 10kb from mmu-mir-497b
mmu-mir-195achr11: 70235042-70235135 [+]
mmu-mir-497achr11: 70234717-70234800 [+]
mmu-mir-497bchr11: 70234692-70234816 [-]
Database links

Mature sequence mmu-miR-497b

Accession MIMAT0031404
Sequence

31 - 

caccacagugugguuuggacgugg

 - 54

Get sequence
Deep sequencing321 reads, 50 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1