Stem-loop sequence mmu-mir-8091

AccessionMI0026018 (change log)
Symbol MGI:Mir8091
DescriptionMus musculus miR-8091 stem-loop
Stem-loop
   ---------       uuccu  u    ug  ugg      uu  gg ga         g              u  u 
5'          uggagau     ug aggg  cu   auuagg  ag  g  ggagugagu guaagcugguggga gc u
            |||||||     || ||||  ||   ||||||  ||  |  ||||||||| |||||||||||||| || c
3'          acuuuug     ac uuuu  gg   uggucu  uc  u  ccuuacuua uauuugaccacccu ug c
   ucacuugaa       -----  -    gu  ---      uu  au -g         a              -  a 
Get sequence
Deep sequencing
688 reads, 2.13 reads per million, 47 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCm38; GCA_000001635.2) Overlapping transcripts
chr19: 41588651-41588789 [+]
intergenic
Database links

Mature sequence mmu-miR-8091

Accession MIMAT0031392
Sequence

41 - 

aggagugagugguaagcuggug

 - 62

Get sequence
Deep sequencing679 reads, 45 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1