Stem-loop sequence stu-MIR169h

AccessionMI0026004 (change log)
DescriptionSolanum tuberosum miR169h stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

4 open access papers mention stu-MIR169h
(6 sentences)

Stem-loop
   --     a         u        ----ucaaa       u 
5'   uagcc aggaugacu gccuaugu         accaauu u
     ||||| ||||||||| ||||||||         |||||||  
3'   aucgg uucuacuga cggauaua         ugguuaa g
   cu     g         -        uuauauuaa       a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138318.1: 155222-155302 [-]
intergenic
Clustered miRNAs
< 10kb from stu-MIR169h
stu-MIR169gJH138318.1: 159255-159347 [-]
stu-MIR169hJH138318.1: 155222-155302 [-]
Database links

Mature sequence stu-miR169h

Accession MIMAT0031372
Sequence

1 - 

uagccaaggaugacuugccu

 - 20

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).