Stem-loop sequence stu-MIR169g

AccessionMI0026003 (change log)
DescriptionSolanum tuberosum miR169g stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

4 open access papers mention stu-MIR169g
(6 sentences)

Stem-loop
   --u     a        u     -   aauacu     uuu    cu a 
5'    agcca ggaugacu gccua cau      accaa   caag  g a
      ||||| |||||||| ||||| |||      |||||   ||||  | a
3'    ucggu ucuacuga cggau gua      ugguu   guuc  c u
   guu     a        -     u   --cagu     --u    au g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138318.1: 159255-159347 [-]
intergenic
Clustered miRNAs
< 10kb from stu-MIR169g
stu-MIR169gJH138318.1: 159255-159347 [-]
stu-MIR169hJH138318.1: 155222-155302 [-]
Database links

Mature sequence stu-miR169g

Accession MIMAT0031371
Sequence

1 - 

uagccaaggaugacuugccu

 - 20

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).