Stem-loop sequence stu-MIR169f

AccessionMI0026002 (change log)
DescriptionSolanum tuberosum miR169f stem-loop
Literature search

4 open access papers mention stu-MIR169f
(6 sentences)

Stem-loop
   --ua          a      u     -----       uu          aauua 
5'     gccaaggaug cuugcc uucau     caaugcc  guaaaaagga     a
       |||||||||| |||||| |||||     |||||||  ||||||||||      
3'     cgguuccuac gaacgg gagua     guuaugg  uauuuuuccu     u
   ucag          -      u     aaagg       --          aaaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138318.1: 169894-169997 [-]
intergenic
Database links

Mature sequence stu-miR169f-5p

Accession MIMAT0031369
Sequence

1 - 

uagccaaggaugacuugccu

 - 20

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR169f-3p

Accession MIMAT0031370
Sequence

86 - 

gcaagcauccuuggcgacu

 - 104

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).