Stem-loop sequence stu-MIR169e

AccessionMI0026001 (change log)
DescriptionSolanum tuberosum miR169e stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

4 open access papers mention stu-MIR169e
(6 sentences)

Stem-loop
   --      a               -u   uu   uaa 
5'   uagcca ggaugacuugccuac  cca  uga   u
     |||||| |||||||||||||||  |||  |||   a
3'   aucggu ccuauugaacggaug  ggu  auu   u
   cu      -               uu   uu   uuu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138085.1: 297829-297901 [+]
intergenic
Clustered miRNAs
< 10kb from stu-MIR169e
stu-MIR169dJH138085.1: 294901-294991 [-]
stu-MIR169cJH138085.1: 295136-295220 [-]
stu-MIR169eJH138085.1: 297829-297901 [+]
Database links

Mature sequence stu-miR169e-5p

Accession MIMAT0031367
Sequence

1 - 

uagccaaggaugacuugccu

 - 20

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR169e-3p

Accession MIMAT0031368
Sequence

55 - 

gcaaguuauccuggcuauc

 - 73

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).