Stem-loop sequence stu-MIR169d

AccessionMI0026000 (change log)
DescriptionSolanum tuberosum miR169d stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

4 open access papers mention stu-MIR169d
(6 sentences)

Stem-loop
   ---    c             c  - a   uauu     a  g  u 
5'    uagc aaggaugacuugc ug c cca    ugaaa gg gu u
      |||| ||||||||||||| || | |||    ||||| || || c
3'    aucg uuucuacuggacg ac g ggu    acuuu cu ua a
   uca    a             a  u g   ucuu     c  g  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138085.1: 294901-294991 [-]
intergenic
Clustered miRNAs
< 10kb from stu-MIR169d
stu-MIR169eJH138085.1: 297829-297901 [+]
stu-MIR169cJH138085.1: 295136-295220 [-]
stu-MIR169dJH138085.1: 294901-294991 [-]
Database links

Mature sequence stu-miR169d-5p

Accession MIMAT0031365
Sequence

1 - 

uagccaaggaugacuugccu

 - 20

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR169d-3p

Accession MIMAT0031366
Sequence

71 - 

gcaggucaucuuuagcuaacu

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).