Stem-loop sequence stu-MIR169c

AccessionMI0025999 (change log)
DescriptionSolanum tuberosum miR169c stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

5 open access papers mention stu-MIR169c
(7 sentences)

Stem-loop
   --          u    u     -cu   uagu      u   uu 
5'   uagccaagga gacu gccug   cca    cuaaaa gug  u
     |||||||||| |||| |||||   |||    |||||| |||   
3'   aucgguuccu cuga cggac   ggu    gauuuu cac  a
   cc          -    -     uuu   --uu      c   ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138085.1: 295136-295220 [-]
intergenic
Clustered miRNAs
< 10kb from stu-MIR169c
stu-MIR169eJH138085.1: 297829-297901 [+]
stu-MIR169cJH138085.1: 295136-295220 [-]
stu-MIR169dJH138085.1: 294901-294991 [-]
Database links

Mature sequence stu-miR169c-5p

Accession MIMAT0031363
Sequence

1 - 

uagccaaggaugacuugccu

 - 20

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR169c-3p

Accession MIMAT0031364
Sequence

68 - 

gcagucuccuuggcuacc

 - 85

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).