Stem-loop sequence stu-MIR169b

AccessionMI0025998 (change log)
DescriptionSolanum tuberosum miR169b stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

5 open access papers mention stu-MIR169b
(7 sentences)

Stem-loop
   --          u    u     ca       uucuu    uu   -ga    u    ua 
5'   uagccaagga gacu gccug  ucauuag     gagg  ugu   uaua caug  u
     |||||||||| |||| |||||  |||||||     ||||  |||   |||| ||||  a
3'   aucgguuccu cuga cggac  gguaguu     cuuc  acg   auau guac  u
   uc          -    -     -c       ----u    uu   aac    -    cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137832.1: 2204840-2204951 [-]
intergenic
Clustered miRNAs
< 10kb from stu-MIR169b
stu-MIR169bJH137832.1: 2204840-2204951 [-]
stu-MIR169aJH137832.1: 2197227-2197346 [+]
Database links

Mature sequence stu-miR169b-5p

Accession MIMAT0031361
Sequence

1 - 

uagccaaggaugacuugccu

 - 20

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR169b-3p

Accession MIMAT0031362
Sequence

95 - 

gcagucuccuuggcuacu

 - 112

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).