Stem-loop sequence stu-MIR169a

AccessionMI0025997 (change log)
DescriptionSolanum tuberosum miR169a stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

4 open access papers mention stu-MIR169a
(6 sentences)

Stem-loop
   --          u    u     ca       uuaauucuu    cua       -    a    g 
5'   uagccaagga gacu gccug  ucauuaa         gagg   gcuugug auau ucau u
     |||||||||| |||| |||||  |||||||         ||||   ||||||| |||| ||||  
3'   aucgguuccu cuga cggac  gguaguu         cuuc   cgaacau ugua agua a
   uc          -    -     -c       --------u    uua       a    c    u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137832.1: 2197227-2197346 [+]
intergenic
Clustered miRNAs
< 10kb from stu-MIR169a
stu-MIR169aJH137832.1: 2197227-2197346 [+]
stu-MIR169bJH137832.1: 2204840-2204951 [-]
Database links

Mature sequence stu-miR169a-5p

Accession MIMAT0031359
Sequence

1 - 

uagccaaggaugacuugccu

 - 20

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR169a-3p

Accession MIMAT0031360
Sequence

103 - 

gcagucuccuuggcuacu

 - 120

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).