Stem-loop sequence stu-MIR156k

AccessionMI0025996 (change log)
DescriptionSolanum tuberosum miR156k stem-loop
Gene family MIPF0000008; MIR156
Literature search

9 open access papers mention stu-MIR156k
(22 sentences)

Stem-loop
   --       -    -                guu   u      au 
5'   ugacaga agag agugagcacacauggu   uuc agcaug  g
     ||||||| |||| ||||||||||||||||   ||| ||||||  u
3'   acugucu ucuc ucacucguguguauca   aag ucguac  u
   cc       a    g                ---   u      au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137923.1: 347706-347793 [-]
intergenic
Database links

Mature sequence stu-miR156k-5p

Accession MIMAT0031357
Sequence

1 - 

ugacagaagagagugagcac

 - 20

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR156k-3p

Accession MIMAT0031358
Sequence

67 - 

gcucacugcucuaucugucacc

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).