Stem-loop sequence stu-MIR156h

AccessionMI0025993 (change log)
DescriptionSolanum tuberosum miR156h stem-loop
Gene family MIPF0000008; MIR156
Literature search

9 open access papers mention stu-MIR156h
(22 sentences)

Stem-loop
   --       -    -         a      gua          au 
5'   ugacaga agag agugagcac cauggu   uucaagcaug  g
     ||||||| |||| ||||||||| ||||||   ||||||||||  u
3'   acugucu ucuc ucacucgug guaucg   aaguucguac  u
   cc       a    g         c      ---          au 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137923.1: 518360-518447 [+]
intergenic
Clustered miRNAs
< 10kb from stu-MIR156h
stu-MIR156hJH137923.1: 518360-518447 [+]
stu-MIR156iJH137923.1: 518632-518719 [+]
Database links

Mature sequence stu-miR156h-5p

Accession MIMAT0031351
Sequence

1 - 

ugacagaagagagugagcac

 - 20

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR156h-3p

Accession MIMAT0031352
Sequence

67 - 

gcucacugcucuaucugucacc

 - 88

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).