Stem-loop sequence stu-MIR156e

AccessionMI0025990 (change log)
DescriptionSolanum tuberosum miR156e stem-loop
Gene family MIPF0000008; MIR156
Literature search

9 open access papers mention stu-MIR156e
(22 sentences)

Stem-loop
   --       -    a        a  u    c  --u     auu 
5'   ugacaga agag gugagcac ca gguu uu   caugg   a
     ||||||| |||| |||||||| || |||| ||   |||||    
3'   acugucu ucuc cacucgug gu ucga aa   guacc   u
   ac       a    g        c  c    a  uuu     ccu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137825.1: 159113-159199 [+]
intergenic
Database links

Mature sequence stu-miR156e

Accession MIMAT0031346
Sequence

1 - 

ugacagaagagagugagcac

 - 20

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).