Stem-loop sequence stu-MIR171e

AccessionMI0025989 (change log)
DescriptionSolanum tuberosum miR171e stem-loop
Gene family MIPF0000030; MIR171_1
Literature search

6 open access papers mention stu-MIR171e
(32 sentences)

Stem-loop
   --      ug                   u   cacaua 
5'   uguugg  ugguucaauuagauaacaa cuc      a
     ||||||  ||||||||||||||||||| |||       
3'   auaacc  gccgaguuaguuuauuguu gag      g
   cu      gu                   u   auauua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138336.1: 218276-218353 [-]
intergenic
Database links

Mature sequence stu-miR171e

Accession MIMAT0031345
Sequence

58 - 

ugauugagccgugccaauauc

 - 78

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).