Stem-loop sequence stu-MIR397

AccessionMI0025987 (change log)
DescriptionSolanum tuberosum miR397 stem-loop
Gene family MIPF0000120; MIR397
Literature search

4 open access papers mention stu-MIR397
(8 sentences)

Stem-loop
   --        c           cau uu      uuu   u 
5'   auugagug agcguugauga   a  ugagaa   cug a
     |||||||| |||||||||||   |  ||||||   ||| u
3'   uaacucac ucgcaacuacu   u  acucuu   ggu u
   ac        a           --u uu      ucc   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138102.1: 591745-591825 [+]
intergenic
Database links

Mature sequence stu-miR397-5p

Accession MIMAT0031341
Sequence

1 - 

auugagugcagcguugaugac

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR397-3p

Accession MIMAT0031342
Sequence

61 - 

caucaacgcuacacucaauca

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).